was calculated by dividing the absolute signal intensity from NUP98-HOXA9, NUP98-HOXA9/N51S, HOXA9, and HOXA9DN samples by that of the control sample. Probes scored as increasing and absent in the numerator, and those scored as decreasing and absent in the denominator were also filtered out. The experiment was performed 2 independent times. Probe sets induced or repressed by 1.74-fold or greater in both experiments were considered differentially expressed. Gene intersection lists were generated using Spotfire DecisionSite 9.1.1 for Functional Genomics. All microarray data reported in the manuscript are described in accordance with MIAME guidelines. Luciferase assay Cells were transfected by electroporation using a Bio-Rad GenePulser with 10 mg pGL4.11 vector or pGL4.11 driven by the indicated promoters and 20 mg of either empty pTracer-CMV/ Bsd vector, or vector expressing HA-tagged NUP98-HOXA9 or NUP98-HOXA9/N51S. To control for efficiency of transfection, 0.5 mg of pRL-TK, which expresses Renilla luciferase, was included. Ten million cells were incubated with the DNA for 10 min at room temperature before electroporation and 10 min after electroporation, and were cultured in 20 mL IMDM media with 10% FBS, 2 mM L-glutamine, and 100 units/mL pencillin/streptomycin. 21150909 Luciferase activity was measured 48 h after electroporation using the Dual Luciferase Reporter Assay System and the results were normalized to Renilla luciferase. KBTBD10: Forward: 59CACATCTCATATTCTTGACCTTTGC39 Reverse: 59CTGGAACTTTTAATCACTAGGGAAAC39 PLN: Forward: 59CCATAAAGTTGCCCTTAATACTGC39 Reverse: 59CTTGTGTGTATGGGAGAAGG39 PLN: Forward: 59CCCGGCTTTACAAAAAAATTATTTCC39 Reverse: 59CACCCCCAAAATAGCAATATGC39 PLN: Forward: 59CAAATGATTTGCTCTAGAGATGGATTTTC39 Reverse: 59CGGGCATCATTCTCCTC39 HEY1: Forward: 59TCACGTGGCACCCAGTACAC39 Reverse: 59GCATCTCATTTCCGGGGAAG39 PCR products were resolved on 2% agarose gels and imaged with a Chemidoc XRS system. Supporting Information Chromatin Immunoprecipitation K562 cells were nucleofected using a Nucleofector device with either empty pTracer-CMV/Bsd vector or vector containing Flag-tagged NUP98-HOXA9 or NUP98-HOXA9/N51S and collected after 12 h. After crosslinking with 1% formaldehyde and quenching with 0.375 M glycine, cells were washed twice with ice-cold TBS. Nuclei were isolated 17594192 by washing with 10 mM Tris-HCl, pH 7.5, 10 mM NaCl, 3 mM MgCl2, 0.5% NP-40 three times and were freeze-thawed. Nuclei were lysed by adding 200 mL of micrococcal nuclease buffer and 1 mL FA lysis buffer with 2 mM PMSF and complete protease inhibitor cocktail. The lysate was sonicated and centrifuged at 17,0006g for 30 min at 4uC. The (+)-Bicuculline manufacturer supernatant was precleared with Sepharose 4B beads for 2 h at 4uC and incubated with anti-Flag agarose M2 antibody overnight at 4uC. The beads were washed twice with FA lysis buffer, once with of FA lysis buffer with 500 mM NaCl, once with ChIP wash buffer, and once with TE. The beads were eluted twice at 65uC for 10 min with a total of 250 mL of 1% SDS in TE. After adding 250 ml TE and 100 mg proteinase K, the eluate was incubated at 37uC for 2 h. Crosslinks were reversed at 65uC overnight followed by phenol chloroform extraction and DNA precipitation with 100 mL 4M LiCl and 1 mL ethanol. KBTBD10, PLN, and HEY1 promoter regions were amplified by PCR using the following primer pairs: Transformation by NUP98-HOXA9 human CD34+ cells were retrovirally transduced with either control MSCV-IRES-GFP
vector or vector expressing wild-type HOXA9. Ce