Howed that a high dose of H2O2 or the pro-oxidant 1-chloro-2,4-dinitrobenzene (CDNB) is able to MedChemExpress 58-49-1 induce GA production and in the process reduces fungal biomass. However, incubating G. lucidum with low doses of H2O2 and CDNB has no effect on GA and biomass production [19]. These results suggest that cell death is related to GA production in G. lucidum. Therefore, in this study, we have tested the hypothesis that apoptosis signaling is linked to GA biosynthesis. A further aim of this study was to apply this novel approach, the induction cell apoptosis, to enhancing the production of fungal secondary metabolites. In the current study, the fungal mycelium of G. lucidum was incubated with aspirin and cell apoptosis was evaluated. GA production and the expression of genes involved in the biosynthesis of GAs were measured. Important regulators of cell apoptosis, including ROS production and MAPK phosphorylation, were also examined to evaluate their putative roles in apoptosis and GA biosynthesis.USA). Fungal cells of G. lucidum were treated with aspirin for 16 hr, fixed with 4 paraformadehyde for 1 hr, washed with PBS, and then digested with cell wall degrading enzymes (0.5 U mL21 of driselase, 1050 U mL21 of b-glucaronidase, 81.25 U mL21 of lyticase, 5 mg mL21 of lysing enzyme, and 0.015 U mL21 of chitinase) for 30 min. Cell permeabilization followed by the TUNEL reaction were conducted according to the manufacturer’s guidelines. To obtain a control nuclear morphology for normal cells using TUNEL staining, fungal cells were incubated with 0.235 U mL21 of DNase I after cell permeabilization and then assessed using the TUNEL reaction mixture. After TUNEL staining, the fungal cells were incubated with 2 mg mL21 of 49, 6diamidino-2-phenylindole (DAPI) in 75 ethanol for 1 hr to allow examination of the cell nuclei. Photographs were taken by fluorescence microscopy (IX70, Olympus, Tokyo, Japan). At least three independent experiments were performed.Detection and quantification of ganoderic acids by HPLCExtraction and detection of ganoderic acids (GAs) from the fungal mycelium was performed as previously described [17]. Dried
mycelium (100 mg) was extracted with methanol, and GAs in supernatant was analyzed by HPLC. 1081537 Lanosta-7,9(11), 24-trien3a-o1-26-oic acid (ganoderic acid 24) was used to construct a calibration curve for production of GA24 and total GAs in the fungal mycelium [17]. Total GAs produced by the fungal mycelium was calculated by adding the peak areas of compounds eluted from 5 to 50 min by HPLC analysis [17].Expression of the genes encoding a squalene synthase and a lanosterol synthaseDNA fragments encoding a putative squalene synthase (SQS) and a 1527786 putative lanosterol synthase (LS) were amplified from G. lucidum BCRC 36111 [17]. Northern blotting analysis was performed using standard procedures. Fungal total RNA was extracted by Trizol reagent (Invitrogen, Carlsbad, CA, USA). Digoxigenin-11-dUTP (Roche Applied Science) was I-BRD9 biological activity incorporated into the SQS DNA by PCR using the primers glssF263 (59TGGACACGATCGAAGATGACATGAC39) and glssR1492 (59GCCATCGTTTGTGGGATCGCACAGAA39). A DNA probe specifically hybridizing to the LS sequence was amplified in a similar way using the primers gllsF1292 (59CGGCGTATCGGCACCAGACGAA39) and gllsR2105 (59TTCGGGTACGATATCGCGACGTTC39). Immunological detection of the Northern Blots using CDP-Star chemiluminescent substrate was conducted following the manufacturer’s recommended procedures (Roche Applied Science). All exper.Howed that a high dose of H2O2 or the pro-oxidant 1-chloro-2,4-dinitrobenzene (CDNB) is able to induce GA production and in the process reduces fungal biomass. However, incubating G. lucidum with low doses of H2O2 and CDNB
has no effect on GA and biomass production [19]. These results suggest that cell death is related to GA production in G. lucidum. Therefore, in this study, we have tested the hypothesis that apoptosis signaling is linked to GA biosynthesis. A further aim of this study was to apply this novel approach, the induction cell apoptosis, to enhancing the production of fungal secondary metabolites. In the current study, the fungal mycelium of G. lucidum was incubated with aspirin and cell apoptosis was evaluated. GA production and the expression of genes involved in the biosynthesis of GAs were measured. Important regulators of cell apoptosis, including ROS production and MAPK phosphorylation, were also examined to evaluate their putative roles in apoptosis and GA biosynthesis.USA). Fungal cells of G. lucidum were treated with aspirin for 16 hr, fixed with 4 paraformadehyde for 1 hr, washed with PBS, and then digested with cell wall degrading enzymes (0.5 U mL21 of driselase, 1050 U mL21 of b-glucaronidase, 81.25 U mL21 of lyticase, 5 mg mL21 of lysing enzyme, and 0.015 U mL21 of chitinase) for 30 min. Cell permeabilization followed by the TUNEL reaction were conducted according to the manufacturer’s guidelines. To obtain a control nuclear morphology for normal cells using TUNEL staining, fungal cells were incubated with 0.235 U mL21 of DNase I after cell permeabilization and then assessed using the TUNEL reaction mixture. After TUNEL staining, the fungal cells were incubated with 2 mg mL21 of 49, 6diamidino-2-phenylindole (DAPI) in 75 ethanol for 1 hr to allow examination of the cell nuclei. Photographs were taken by fluorescence microscopy (IX70, Olympus, Tokyo, Japan). At least three independent experiments were performed.Detection and quantification of ganoderic acids by HPLCExtraction and detection of ganoderic acids (GAs) from the fungal mycelium was performed as previously described [17]. Dried mycelium (100 mg) was extracted with methanol, and GAs in supernatant was analyzed by HPLC. 1081537 Lanosta-7,9(11), 24-trien3a-o1-26-oic acid (ganoderic acid 24) was used to construct a calibration curve for production of GA24 and total GAs in the fungal mycelium [17]. Total GAs produced by the fungal mycelium was calculated by adding the peak areas of compounds eluted from 5 to 50 min by HPLC analysis [17].Expression of the genes encoding a squalene synthase and a lanosterol synthaseDNA fragments encoding a putative squalene synthase (SQS) and a 1527786 putative lanosterol synthase (LS) were amplified from G. lucidum BCRC 36111 [17]. Northern blotting analysis was performed using standard procedures. Fungal total RNA was extracted by Trizol reagent (Invitrogen, Carlsbad, CA, USA). Digoxigenin-11-dUTP (Roche Applied Science) was incorporated into the SQS DNA by PCR using the primers glssF263 (59TGGACACGATCGAAGATGACATGAC39) and glssR1492 (59GCCATCGTTTGTGGGATCGCACAGAA39). A DNA probe specifically hybridizing to the LS sequence was amplified in a similar way using the primers gllsF1292 (59CGGCGTATCGGCACCAGACGAA39) and gllsR2105 (59TTCGGGTACGATATCGCGACGTTC39). Immunological detection of the Northern Blots using CDP-Star chemiluminescent substrate was conducted following the manufacturer’s recommended procedures (Roche Applied Science). All exper.