Index. aAll 8 candidate HKGs showed strong correlation (correlation coefficient r value

Index. aAll 8 candidate HKGs showed strong correlation (correlation coefficient r value from 0.69 to 0.93) and were combined into an index, which was then used to compute the correlation between each HKG and the index. doi:10.1371/journal.pone.0048367.gunstimulated CD4+ T cells were studied. It is possible that PPIA level is low in resting CD4+ T cells. Upon allergen stimulation, such as in acute asthmatics or chronic asthmatics with continuous allergen exposure, PPIA expression would be higher than normal. This phenomenon was seen previously with other chemoattractants such as eotaxin, RANTES, MIP-1a, and MCP-1 [23,24,25]. Our previous study identified PPIA as a stable KS-176 chemical information expressed HKG in airway epithelial cells [26], this paper has provided helpful information to a dozen of studies since its publication (citations from 11967625 Google Scholar). Several publications used PPIA as a HKG to normalize the expression levels of target genes and found meaningful differential expressions of target genes [27,28], Current study identified B2M and RPLP0 as the most optimal HKGs in gene expression studies involving human blood CD4+ T Table 4. Primer sequences for housekeeping genes.cells derived from normal subjects and asthmatics with and without depression. The different results from the two studies may be explained by the fact that the cell types in the two studies were different and our results have also strengthened the importance of optimal HKGs selection MedChemExpress KDM5A-IN-1 before performing any qRT-PCR in different disease conditions. Since asthma with depression have been considered to influence the disease process of asthma certainly, exploring the underlying pathophysiological mechanisms is necessary. However, before we determine the molecular basis, selecting optimal HKGs is the first and crucial step.ConclusionsTo our knowledge, this is the first study to identify the most stable HKGs in CD4+ T cells and depressive/non-depressive asthmatic disease status. B2M and RPLP0 were identified as the most optimal combination of HKGs in gene expression studies involving human blood CD4+ T cells derived from normal, depressive asthmatics and non-depressive asthmatics. Moreover, the present findings question the suitability of the PPIA gene as the HKG for such studies due to its significantly lower expression levels in asthmatic CD4+ T cells. Furthermore, careful comparison of the gene expression profiles of purified CD4+ T cells based on information from this study will further elucidate the molecular basis of the incidence and development of asthma with or without depression.Symbol RN28S1 RPLP0 ACTB PPIA GAPDH PGK1 B2M GUSB RPL13AForward primer CTCCCACTTATTCTACACCT CTGGAAGTCCAACTACTTCCT GAAGATCAAGATCATTGCTCCT TCCTGGCATCTTGTCCAT AAGCTCATTTCCTGGTATGACA GCCACTTGCTGTGCCAAATG CTATCCAGCGTACTCCAAAG CCAGTTTGAGAACTGGTATAAG CTTTCCTCCGCAAGCGGATReverse primer CCACTGTCCCTACCTACTAT 15857111 CATCATGGTGTTCTTGCCCAT TACTCCTGCTTGCTGATCCA TGCTGGTCTTGCCATTCCT TCTTACTCCTTGGAGGCCATGT CCCAGGAAGGACTTTACCTT GAAAGACCAGTCCTTGCTGA CTGGTACTCTTCAGTGAACAT CCACCATCCGCTTTTTCTTAcknowledgmentsWe thank Dr. Ya-Jing Meng, a psychiatrist for evaluation the psychological conditions of these subjects, Yan He and Qing-Jie Xia for helping experiment technology; and all of the subjects for their participation.doi:10.1371/journal.pone.0048367.tSelection of Suitable Housekeeping GenesFigure 3. Ranking the housekeeping genes (HKGs) according to their expression stability M determined using geNorm. A stepwise exclusion of the least.Index. aAll 8 candidate HKGs showed strong correlation (correlation coefficient r value from 0.69 to 0.93) and were combined into an index, which was then used to compute the correlation between each HKG and the index. doi:10.1371/journal.pone.0048367.gunstimulated CD4+ T cells were studied. It is possible that PPIA level is low in resting CD4+ T cells. Upon allergen stimulation, such as in acute asthmatics or chronic asthmatics with continuous allergen exposure, PPIA expression would be higher than normal. This phenomenon was seen previously with other chemoattractants such as eotaxin, RANTES, MIP-1a, and MCP-1 [23,24,25]. Our previous study identified PPIA as a stable expressed HKG in airway epithelial cells [26], this paper has provided helpful information to a dozen of studies since its publication (citations from 11967625 Google Scholar). Several publications used PPIA as a HKG to normalize the expression levels of target genes and found meaningful differential expressions of target genes [27,28], Current study identified B2M and RPLP0 as the most optimal HKGs in gene expression studies involving human blood CD4+ T Table 4. Primer sequences for housekeeping genes.cells derived from normal subjects and asthmatics with and without depression. The different results from the two studies may be explained by the fact that the cell types in the two studies were different and our results have also strengthened the importance of optimal HKGs selection before performing any qRT-PCR in different disease conditions. Since asthma with depression have been considered to influence the disease process of asthma certainly, exploring the underlying pathophysiological mechanisms is necessary. However, before we determine the molecular basis, selecting optimal HKGs is the first and crucial step.ConclusionsTo our knowledge, this is the first study to identify the most stable HKGs in CD4+ T cells and depressive/non-depressive asthmatic disease status. B2M and RPLP0 were identified as the most optimal combination of HKGs in gene expression studies involving human blood CD4+ T cells derived from normal, depressive asthmatics and non-depressive asthmatics. Moreover, the present findings question the suitability of the PPIA gene as the HKG for such studies due to its significantly lower expression levels in asthmatic CD4+ T cells. Furthermore, careful comparison of the gene expression profiles of purified CD4+ T cells based on information from this study will further elucidate the molecular basis of the incidence and development of asthma with or without depression.Symbol RN28S1 RPLP0 ACTB PPIA GAPDH PGK1 B2M GUSB RPL13AForward primer CTCCCACTTATTCTACACCT CTGGAAGTCCAACTACTTCCT GAAGATCAAGATCATTGCTCCT TCCTGGCATCTTGTCCAT AAGCTCATTTCCTGGTATGACA GCCACTTGCTGTGCCAAATG CTATCCAGCGTACTCCAAAG CCAGTTTGAGAACTGGTATAAG CTTTCCTCCGCAAGCGGATReverse primer CCACTGTCCCTACCTACTAT 15857111 CATCATGGTGTTCTTGCCCAT TACTCCTGCTTGCTGATCCA TGCTGGTCTTGCCATTCCT TCTTACTCCTTGGAGGCCATGT CCCAGGAAGGACTTTACCTT GAAAGACCAGTCCTTGCTGA CTGGTACTCTTCAGTGAACAT CCACCATCCGCTTTTTCTTAcknowledgmentsWe thank Dr. Ya-Jing Meng, a psychiatrist for evaluation the psychological conditions of these subjects, Yan He and Qing-Jie Xia for helping experiment technology; and all of the subjects for their participation.doi:10.1371/journal.pone.0048367.tSelection of Suitable Housekeeping GenesFigure 3. Ranking the housekeeping genes (HKGs) according to their expression stability M determined using geNorm. A stepwise exclusion of the least.