Rocess could provide guidelines and options for the Sermorelin site preparative scale production of unstable proteins as well as for exploiting the stabilizing role of osmolytes for biotechnology purposes.Table 2. CF reaction protocol for compound screening.Compound Premix: Putrescine Spermidine K+-glutamate NH4+-glutamate Mg2+-glutamate Na+-oxalate Na+-pyruvate Folinic acid DTT NAD+ Individual compounds: 20 amino acid mix PEP-K+ CoA-Na+ E. coli tRNA T7-RNA-polymerase NTP-Mix: ATP NTP-Mix: C/G/UTP (each) DTT Plasmid template E. coli S30 extract Mg -glutamate H2O1 2+Stock 10-fold 15 mM 15 mM 2500 mM 100 mM 100 mM 40 mM 330 mM 340 mg/ml 10 mM 5.3 mMFinal 1-fold 1.5 mM 1.5 mM 250 mM 10 mM 10 mM1 4 mM 33 mM 34 mg/ml 1 mM 0.53 mMRange10?0 mM8 mM each 1M 30 mM 40 mg/ml 1.4 mg/ml 90 mM 60 mM 500 mM 0.3 mg/ml 100 100 mM2 mM each 30 mM 0.26 mM 0.17 mg/ml 10 mg/ml 2.5 mM 1.7 mM optional 0.015 mg/ml 24 or 31 2 16 mM1 fill up to 25 ml 22?5 20?0 mM1 1?0 mM 5?0 mg/mlMaterials and Methods ChemicalsPEG 6000 was obtained from Applichem (Darmstadt, Germany). All other chemicals were from Sigma-Aldrich (Taufkirchen, Germany) and obtained at highest purity.DNA TemplatesShifted green fluorescence protein (sGFP) was cloned into the pIVEX 2.3d vector and expressed with a C-terminal poly(His)10 tag using restriction free cloning. The coding region of human GNA1 (GenBank access code BC012179.1) was first cloned into the vector pET21a. A C-terminal fusion of sGFP to GNA1 was then constructed by restriction free cloning. The forward primer had a 24 base overlap complementary to the 59 end of the desired insertion site of the vector and followed by a start codon and 20?25 bases of the 59 end of GNA1 coding sequence. The reverse primer annealed to the vector with 24 bases complementary to the 39 end of the insertion site. A pair of primers was furthermore designed in order to fuse the TEV-sGFP gene sequence after the GNA1 gene sequence (Table 1). The CurA halogenase domain was cloned into the vector pET28b (Merck Bioscience, Darmstadt, Germany) and expressed with an N-terminal His6-tag. The native protein sequence covers the amino acids 1599 to 1930 of CurA Table 1. Construction of DNA templates.if not used as screening compound, the total final Mg2+ concentration was adjusted to 26 mM. 2 24 were used for analytical scale screening reactions, whereas 31 were used for preparative scale reactions. doi:10.1371/journal.pone.0056637.taccording to the sequence accessible at NCBI (GenBank accession code: AAT70096.1). DNA templates used for CF expression were transformed into
E. coli strain DH5a and isolated by standard plasmid purification kits (Macherey-Nagel, Duren, Germany). ?Construct sGFPVector pIVEX 2.3dModification C-poly(His)Primer sequence1 F: TTTTGTTTAACTTTAAGAAGGAGATATAC ATATGAGCAAAGGAGAAGAACTTTTCAC R: GTGGTGGTGGTGGTGGTGGTGGTGGGATC CCTCGAGTGCGGCCGCAAGCTTTTTGTAGNApET21aC-poly(His)F: 1326631 CGCGGATCCATGAAACCTGATGAAACTCCT R: 64849-39-4 site CCGCTCGAGCTTTAGAAACCTCCGACACAGNA1-sGFPpET21aC-poly(His)10 TEV cleavageF: CTACATGTGTCGGAGGTTTCTAAAGGGCG AAAACCTGTACTTCCAGGGCG R: GGTGGTGGTGGTGGTGGTGCTCGAGTGCG GCCGCAAGCTTTTTGTAGAGCCurA- HalogenasepET28bN-poly(His)F: TCATGCCATATGCCAAAAACTATGA ACCGGGA R: TCATCGCTCGAGTTATTAGATGCTTG GTGTTTCCF: Forward; R: Reverse. doi:10.1371/journal.pone.0056637.tChemical Chaperones for Improving Protein QualityCell-free ExpressionBatch CF reactions were performed in 96 well V-shape microplates (PS-microplate 96 well V-shape, Greiner Bio-One, Frickenhausen, Germany) in a final reac.Rocess could provide guidelines and options for the preparative scale production of unstable proteins as well
as for exploiting the stabilizing role of osmolytes for biotechnology purposes.Table 2. CF reaction protocol for compound screening.Compound Premix: Putrescine Spermidine K+-glutamate NH4+-glutamate Mg2+-glutamate Na+-oxalate Na+-pyruvate Folinic acid DTT NAD+ Individual compounds: 20 amino acid mix PEP-K+ CoA-Na+ E. coli tRNA T7-RNA-polymerase NTP-Mix: ATP NTP-Mix: C/G/UTP (each) DTT Plasmid template E. coli S30 extract Mg -glutamate H2O1 2+Stock 10-fold 15 mM 15 mM 2500 mM 100 mM 100 mM 40 mM 330 mM 340 mg/ml 10 mM 5.3 mMFinal 1-fold 1.5 mM 1.5 mM 250 mM 10 mM 10 mM1 4 mM 33 mM 34 mg/ml 1 mM 0.53 mMRange10?0 mM8 mM each 1M 30 mM 40 mg/ml 1.4 mg/ml 90 mM 60 mM 500 mM 0.3 mg/ml 100 100 mM2 mM each 30 mM 0.26 mM 0.17 mg/ml 10 mg/ml 2.5 mM 1.7 mM optional 0.015 mg/ml 24 or 31 2 16 mM1 fill up to 25 ml 22?5 20?0 mM1 1?0 mM 5?0 mg/mlMaterials and Methods ChemicalsPEG 6000 was obtained from Applichem (Darmstadt, Germany). All other chemicals were from Sigma-Aldrich (Taufkirchen, Germany) and obtained at highest purity.DNA TemplatesShifted green fluorescence protein (sGFP) was cloned into the pIVEX 2.3d vector and expressed with a C-terminal poly(His)10 tag using restriction free cloning. The coding region of human GNA1 (GenBank access code BC012179.1) was first cloned into the vector pET21a. A C-terminal fusion of sGFP to GNA1 was then constructed by restriction free cloning. The forward primer had a 24 base overlap complementary to the 59 end of the desired insertion site of the vector and followed by a start codon and 20?25 bases of the 59 end of GNA1 coding sequence. The reverse primer annealed to the vector with 24 bases complementary to the 39 end of the insertion site. A pair of primers was furthermore designed in order to fuse the TEV-sGFP gene sequence after the GNA1 gene sequence (Table 1). The CurA halogenase domain was cloned into the vector pET28b (Merck Bioscience, Darmstadt, Germany) and expressed with an N-terminal His6-tag. The native protein sequence covers the amino acids 1599 to 1930 of CurA Table 1. Construction of DNA templates.if not used as screening compound, the total final Mg2+ concentration was adjusted to 26 mM. 2 24 were used for analytical scale screening reactions, whereas 31 were used for preparative scale reactions. doi:10.1371/journal.pone.0056637.taccording to the sequence accessible at NCBI (GenBank accession code: AAT70096.1). DNA templates used for CF expression were transformed into E. coli strain DH5a and isolated by standard plasmid purification kits (Macherey-Nagel, Duren, Germany). ?Construct sGFPVector pIVEX 2.3dModification C-poly(His)Primer sequence1 F: TTTTGTTTAACTTTAAGAAGGAGATATAC ATATGAGCAAAGGAGAAGAACTTTTCAC R: GTGGTGGTGGTGGTGGTGGTGGTGGGATC CCTCGAGTGCGGCCGCAAGCTTTTTGTAGNApET21aC-poly(His)F: 1326631 CGCGGATCCATGAAACCTGATGAAACTCCT R: CCGCTCGAGCTTTAGAAACCTCCGACACAGNA1-sGFPpET21aC-poly(His)10 TEV cleavageF: CTACATGTGTCGGAGGTTTCTAAAGGGCG AAAACCTGTACTTCCAGGGCG R: GGTGGTGGTGGTGGTGGTGCTCGAGTGCG GCCGCAAGCTTTTTGTAGAGCCurA- HalogenasepET28bN-poly(His)F: TCATGCCATATGCCAAAAACTATGA ACCGGGA R: TCATCGCTCGAGTTATTAGATGCTTG GTGTTTCCF: Forward; R: Reverse. doi:10.1371/journal.pone.0056637.tChemical Chaperones for Improving Protein QualityCell-free ExpressionBatch CF reactions were performed in 96 well V-shape microplates (PS-microplate 96 well V-shape, Greiner Bio-One, Frickenhausen, Germany) in a final reac.