N kit (BD Biosciences, San Jose, CA, USA) and PI staining buffer (SigmaAldrich, Darmstadt, Germany) assay method in accordance with the manufacturer’s directions.Cancers 2021, 13,four ofFinally, all samples were analyzed by BD Accuri C6 flow cytometer (BD, Biosciences, San Jose, CA, USA). two.6. Western Blot and RealTime Polymerase Chain Reaction (PCR) Western blot and realtime PCR had been performed as previously described [21]. The antibodies utilized were as above along with the precise primers have been as follows: ORC1 (forward primer: GTCCAATGTTGTAGCCGTGC, reverse primer: CGACGCTGAGATGGGATTGT) and GAPDH (forward primer: GCACCGTCAAGGCTGAGAAC, reverse primer: TGGTGAAGACGCCAGTGGA). two.7. RNASeq Cells have been treated with all the inhibitors in the indicated concentrations alone or in mixture, then total RNA was purified by trizol technique, and RNA integrity was confirmed by 2100 Bioanalyzer (Agilent Technologies Santa Clara, CA, USA). Sequencing was performed by HiSeq method (Illumina, San Diego, CA, USA) in accordance with the manufacturer’s guidelines, and information processing and analyzing have been performed by Novogene Bioscience (Beijing, China). two.8. LentivirusMediated Modest Hairpin RNA (lentishRNA) against ORC1 The LentishRNA vector method (PGCSILGFP) was purchased and constructed from GeneChem Corporation (Shanghai, China). The ORC1 shRNA sequences have been designed as follows: gcCACGTTTCAACAGATATAT, ccACCAAGTCTATGTGCAAAT. Nonsilencing shRNA was Tesaglitazar site results were interpreted by two independent expert pathologists from the pathology division of Peking University Cancer Hospital within a doubleblinded manner. two.11. Statistical Analysis Data were represented as mean SD from three independent experiments and representative results are shown within the figures. All statistical analyses were carried out applying the IBM SPSS Statistics (Version 22.0; IBM Corp.
