Ine within the Saccharomyces Genome Deletion Project web site (http:www-sequence.
Ine within the Saccharomyces Genome Deletion Project ALDH1 Storage & Stability website (http:www-sequence.stanford.edugroup yeast_deletion_projectdeletions3.html). For building on the mRFP-tagged strains the same wild-type 1278b strain 23.344c was transformed using the mRFP::KanMX6 cassette previously amplified by PCR from pFA6-mRFP::KanMX6 (Huh et al., 2003). To introduce the mutation K9R, K16R, an internal piece of GAP1 ORF was deleted by replacement with URA3 in the genome. A forward oligonucleotide containing the (-175)-135) bp region of GAP1 plus homology to URA3 cassette in pRS316 (5-GAAGGTGAAGTCCACTTAAAT GAATGTCAATGAGACGATGAGATTGTACTGAGAGTGCAC -3) as well as a reverse oligonucleotide containing the (432)(394) of GAP1 plus homology to URA3 cassette in pRS316 (5-ACTCACCCAGAGCCATAACCATAGCGTAAATCATGGT ACCCTGTGCGGTATTTCACACCG-3) have been made use of to amplify the replacement URA3 fragment. The strain was subsequently transformed with the corresponding GAP1 ORF piece amplified from YCpGap1K9R,K16R plasmid (Soetens et al., 2001) employing the forward oligonucleotide (5-GATTTGGT AACTGATAAG-3) plus the reverse oligonucleotide (5CAACCAACCATTGTAACA-3). Collection of the replacement took place in 5-FOA. For microscopy experiments the plasmids pGAP1-GFP or pGAP1Y395C-GFP were transformed in either 21.983c or in the mRFP strains (genomic GAP1-mRFP, MRT287; genomic gap1K9R,K16R-mRFP, MRT291). All experiments were performed with nitrogen-starved cells, the cells had been cultured at 30 into exponential phase (OD600 = 1.five) in minimal medium, containing 0.17 (wv) Difco yeast Leishmania list nitrogen base devoid of amino acids and without having or with 0.5 ammonium sulphate, and 2 glucose, supplemented with full mixture without uracil or with out uracil and histidine (CSM-Ura, or CSM-Ura-His, from MP Biomedicals). Exponential-phase cells had been harvested, suspended in nitrogen starvation medium (NSM), containing 0.17 (wv) Difco yeast nitrogen base without having amino acids and without ammonium sulphate and 4 glucose, and incubated beneath shaking for 24 h at 30 .Biochemical determinationsTrehalase activity just after addition of amino acids was determined in crude cell extracts as previously described (Donaton et al., 2003). Cells starved for nitrogen had been collected for 30 min on ice, harvested, washed twice with MesKOH buffer (25 mM, pH six) and resuspended in fresh nitrogen starvation medium with four glucose at a density of 25 mg wet weight per ml. The glucose liberated was assayed by the glucose oxidaseperoxidase technique by adding 200 l of GOD-PAP (Dialab). The protein level was determined by the Lowry process. The particular trehalase activity is expressed as nmol glucose liberated min-1 (mg protein)-1.Transport assaysAmino acid transport in intact cells was assayed by the usage of [14C]-labelled L-citrulline (Perkin Elmer), L-lysine (Perkin Elmer) and [3H]-labelled L-histidine (ViTrax) as previously described (Donaton et al., 2003) as well as custom-made [14C]-labelled L-Asp–L-Phe (ViTrax). Transport activity is expressed as nmol substrate transported min-1 (mg protein)-1. For SCAM evaluation, 10 mM (final concentration) 2aminoethyl methanethiosulphonate, hydrobromide (MTSEA) (Toronto Study Chemicals) was added to gap1 cells expressing pFL38-Gap1, pFL38-Gap1S388C, or pFL38Gap1V389C, ten min before addition of amino acid. MTSEA was dissolved in nitrogen starvation medium just just before use.Fluorescence microscopyFor fluorescent localization studies, imaging was carried out with an Olympus FV1000 confocal laser scanning biological mic.
