Se Chain Reaction (RTPCR)To identify the predominant isoform of the
Se Chain Reaction (RTPCR)To identify the predominant isoform of the human PC mRNA in...
Xolide, aurelione, and Henkel 100 (Henkel, Dusseldorf, Germany) [16]. ?Oligonucleotides1) hTAAR1_fwd: GCGCGGCCGCACCATGATGCCCTTTTGCCACAATATAATTAATAT
Xolide, 166518-60-1 chemical information aurelione, and Henkel 100 (Henkel, Dusseldorf, Germany) . ?Oligonucleotides1) hTAAR1_fwd:...
Ith 1 osmium tetroxide containing 1.5 potassium cyanoferrate, gradually dehydrated in ��ethanol and
Ith 1 osmium tetroxide containing 1.5 PIM-447 (dihydrochloride) potassium cyanoferrate, gradually dehydrated in ��ethanol...
Verage of two experiments with 6 replicates and calculated from dose-response curves
Verage of two experiments with six replicates and calculated from dose-response curves generated with...
O confirm the functional consequences of 9-TB-mediated airway epithelial NF-kB activation.
O confirm the functional consequences of 9-TB-mediated airway epithelial NF-kB activation. Total TBHQ biological...
With Picrosirius have been utilized to get 50 photomicrographs from heart tissue with
With Picrosirius were used to obtain 50 Imazamox photomicrographs from heart tissue with a...
Ired A bases were found to be mostly stacked into the
Ired A bases were found to be mostly stacked into the helix continuously with...
Ind the peptidoglycan layerAFM Study of Effects between EGCG and Cefotaximeof
Ind the peptidoglycan layerAFM Study of Effects between EGCG and Cefotaximeof Gram-negative bacteria because...
Nsidered statistically significant. All data were analysed using SPSS version 20 (SPSS
Nsidered statistically significant. All data were analysed using SPSS version 20 (SPSS Inc, Chicago,...
Sample injections at different times. It should be noted that y-scale
Sample injections at different times. It should be noted that y-scale is higher for...